il 2 signal peptide sequence mature IL-2 protein coding sequence

Dr. Chloe Wang logo
Dr. Chloe Wang

il 2 signal peptide sequence ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACGAATTCG - Commonsignal peptidesequences IL2 gene / cDNA is a protein-coding gene Unraveling the Il-2 Signal Peptide Sequence: A Gateway to Protein Secretion

Aldesleukinsequence The il 2 signal peptide sequence is a critical element in the production and secretion of interleukin-2 (IL-2). This short peptide segment, located at the N-terminus of the nascent protein, acts as a molecular "address label," directing the protein to the secretory pathway within the cell. Understanding the intricacies of the il 2 signal peptide sequence is paramount for researchers in fields ranging from immunology to biotechnology, enabling precise control over protein expression and secretion.

Interleukin-2 (IL-2), a vital cytokine produced primarily by activated CD4-positive helper T-cells, plays a crucial role in the immune response作者:D Vatakis·2011·被引用次数:16—We examined the effect of two leadersequences, one from a transmembrane molecule (H2-Ld) and another from a secreted molecule (rat KC chemokine), on the immunogenicity of DNA epitope vaccines. The chemokine leader enhanced vaccine immunogenicity, thus underscoring the importance of the leadersequencein DNA .... It is essential for the proliferation, differentiation, and survival of T-cells, as well as the activation of natural killer (NK) cells and other immune cells. The IL2 gene / cDNA is a protein-coding gene located on chromosome 4q27 in humans and is conserved across various mammalian species, including chimpanzees, mice, and rats, highlighting its evolutionary importance.

The Structure and Function of Signal Peptides

Signal peptides are characterized by three distinct domains: an N-terminal basic domain, a central hydrophobic core, and a C-terminal cleavage siteIL-2 Signal (CVCM82). This structure is highly conserved across many secreted proteins, not just IL-2. The hydrophobic core is particularly important for threading the protein through cellular membranes, typically the endoplasmic reticulum membrane during the secretion process in eukaryotes. Once the protein enters the secretory pathway, the signal peptide is usually cleaved off by a specific enzyme called signal peptidase, leaving the mature protein to fold and undergo further modificationsIl2 - Interleukin-2 - Mus musculus (Mouse) | UniProtKB.

Research has demonstrated that alterations to the IL-2 signal peptide can significantly impact protein secretion.作者:L Zhang·2005·被引用次数:161—Signal peptides, located at the N-terminus of nascent secreted proteins, characteristically have three domains: (1) a basic domain at the N- ... Studies have shown that modifying the signal peptide can augment protein secretion both *in vitro* and *in vivo*.The Signal Peptide Sequence Impacts the Immune Response ... This finding underscores the importance of optimizing signal peptides for efficient recombinant protein production. For instance, a specific IL-2 signal peptide sequence, MRRMQLLLLIALSLALVTNS, has been extensively used to facilitate protein secretion in mammalian expression systems.作者:Z Chen·1998—Secretory expression of the fusion protein composed of humanIL-2and PreS antigen of hepatitis B virus in mammalian cells. Bulletin; Published: May 1998. This sequence exemplifies the typical hydrophobic core characteristic of effective signal peptides.

Applications and Research Frontiers

The ability to manipulate the il 2 signal peptide sequence has opened up numerous avenues for research and application.Signal peptides(SP) are shortpeptideslocated in the N-terminal of proteins, carrying information for protein secretion. They are ubiquitous to all ... In molecular biology, researchers often fuse the IL-2 signal peptide to the N-terminus of a gene of interest to ensure its efficient secretion from the host cells作者:G Rojas·2019·被引用次数:22—BlockingIL-2 signalin vivo with anIL-2antagonist reduces tumour growth through the control of regulatory T cells. J. Immunol. 200, 3475 .... This technique is widely employed in the production of recombinant proteins for therapeutic purposes, diagnostics, and fundamental researchSignal peptides(SP) are shortpeptideslocated in the N-terminal of proteins, carrying information for protein secretion. They are ubiquitous to all .... For example, vectors like the Mammalian expression vector with C terminal IL-2 signal peptide are designed to leverage this signal peptide for enhanced protein export.

Furthermore, the Signal Peptide Database is a valuable resource for researchers, cataloging numerous signal peptide sequences from various organisms and proteins, including entries like IL2_HUMAN for human Interleukin-2 and IL2_MUSSP for mouse Interleukin-2.The Signal Peptide Sequence Impacts the Immune Response ... These databases aid in identifying and selecting optimal signal peptides for specific expression needs."Interleukin-2 Promoter/Enhancer Controlled Expression of ...

Recent advancements in computational biology have also led to the development of AI-based tools for predicting and designing effective signal peptides. Studies utilizing attention-based neural networks have shown that these engineered signal peptides can significantly increase AP levels in the medium compared to wild-type IL-2 sequences, further highlighting the potential for rational design in optimizing protein secretion.Signal peptides(SP) are shortpeptideslocated in the N-terminal of proteins, carrying information for protein secretion. They are ubiquitous to all ...

The IL-2 signal peptide is not solely confined to the direct secretion of IL-2.作者:D Vatakis·2011·被引用次数:16—We examined the effect of two leadersequences, one from a transmembrane molecule (H2-Ld) and another from a secreted molecule (rat KC chemokine), on the immunogenicity of DNA epitope vaccines. The chemokine leader enhanced vaccine immunogenicity, thus underscoring the importance of the leadersequencein DNA ... It has also been employed in fusion proteins, such as the fusion of human IL-2 with PreS antigen of hepatitis B virus for secretory expression in mammalian cells.Signal peptide This demonstrates the versatility of the signal peptide as a tool for directing diverse proteins into the secretory pathway.

In essence, the il 2 signal peptide sequence serves as an indispensable molecular determinant for protein exportThe Long Signal Peptide Isoform and Its Alternative .... Its well-defined structure and functional role make it a cornerstone for biotechnological applications and a fascinating subject of study in cell biology and immunology. Further research into the nuances of signal peptide function, including variations in sequences and their impact on protein folding and immune response, promises to yield even more sophisticated methods for controlling protein expression and harnessing the power of interleukins and other secreted proteins.Cytokine produced by activated CD4-positive helper T-cells and to a lesser extend activated CD8-positive T-cells and natural killer (NK) cells.

Log In

Sign Up
Reset Password
Subscribe to Newsletter

Join the newsletter to receive news, updates, new products and freebies in your inbox.